- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Monoclonal antibody HA.11 was raised against the twelve amino acid peptide CYPYDVPDYASL.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform. - Application Notes
Additional tested and reported applications of the 16B12 clone for the relevant formats include: western blot (WB), immunocytochemistry (ICC), immunoprecipitation (IP), and flow cytometry (FC).
*Our Posi-Tag Control Protein (931301) can be used as a helpful positive control for this antibody.
This second-generation HA antibody is an excellent substitute for the 12CA5 monoclonal antibody. The HA.11 antibody recognizes the influenza hemagglutinin epitope (YPYDVPDYA) which has been used extensively as a general epitope tag in expression vectors. The extreme specificity of the antibody allows unambiguous identification and quantitative analysis of the tagged protein. The HA.11 antibody recognizes HA epitopes located in the middle of protein sequences as well as at the N- or C-terminus.
- Additional Product Notes
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g.?10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A , B represents either C, G, or T , and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library.
- Application References
(PubMed link indicates BioLegend citation) -
- Kim JY, et al. 2003. J Neurosci. 23:5561. (IP, WB)
- Helliwell SB, et al. 2001. J Cell Biol. 153:649. (WB)
- Bennett BD, et al. 2000. J Biol Chem. 275:37712. (IF, IP, WB)
- Royer Y, et al. 2005. J. Biol. Chem. 29:27251. (FC)
- Smith BA, et al. 2012. Genes Cancer. 3:550. (IHC) PubMed
- Hogarth C, et al. 2015. Biol Reprod. 93:19. PubMed
- G?rtz D, et al. 2015. Sci Rep. 5:14685. PubMed
- Wilson C, et al. 2015. PLoS One. 10:0139579. PubMed
- Smith B, et al. 2012. Genes Cancer. 3:550-563. PubMed
- Liu Z, et al. 2016. Nature. 530:98-102. PubMed
- Thoms M, et al. 2016. Nucleic Acids Res. 44:926-39. PubMed
- Kim Y, et al. 2016. Nat Commun. 7:10347. PubMed
- Rodríguez-Escudero M, et al. 2016. PLoS One. 11:0148032. PubMed
- Lehmann W, et al. 2016. Nat Commun. 7:10498. PubMed
- Testoni E, et al. 2016. EMBO Mol Med. 8: 105-16. PubMed
- Padilla S, et al. 2016. Nat Neurosci. 10.1038/nn.4274. PubMed
- Martins J, et al. 2016. J Cell Sci. 129:1271-82. PubMed
- Matak P, et al. 2016. Proc Natl Acad Sci U S A. 113:3428-35. PubMed
- Starokadomskyy P, et al. 2016. Nat Immunol. 17:495-504. PubMed
- Mitxelena J, et al. 2016. Nucleic Acids Res. 44:5557-70. PubMed
- Thongthip S, et al. 2016. Genes Dev. 30:645-59. PubMed
- Aaes T, et al. 2016. Cell Rep. 15:274-87. PubMed
- Hodge C, et al. 2016. J Biol Chem. 291:9396-9410. PubMed
- Alagramam K, et al. 2016. Nat Chem Biol. 12:444-51. PubMed
- Veit G, et al. 2016. PLoS Biol. 14:1002462. PubMed
- Lee B, et al. 2016. Development. 143:1721-31. PubMed
- Douchi D, et al. 2016. Plant Cell. 28:1182-99. PubMed
- Avgousti D, et al. 2016. Nature. 535:173-77. PubMed
- Shin H, et al. 2015. Nature. 534:553-7. PubMed
- Gross G, et al. 2016. Nat Methods. 10.1038/nmeth.3894. PubMed
- Dick M, et al. 2016. Nat Commun. 7:11929. PubMed
- Aldrin-Kirk P, et al. 2016. Neuron. 90:955-68. PubMed
- Fan R, et al. 2016. Nat Med. 22:780-91. PubMed
- Rowald K, et al. 2016. Cell Rep. 15:2679-91. PubMed
- Rampal R, Awasthi A, Ahuja V 2016. Development. 143:2334-43. PubMed
- Faden F, et al. 2016. Nat Commun. 7:12202. PubMed
- Lawson C, et al. 2016. Cancer Res. 76: 3826-37. PubMed
- Szargel R, et al. 2016. Hum Mol Genet. 10.1093/hmg/ddw189.. PubMed
- Damez-Werno D, et al. 2016. Proc Natl Acad Sci U S A. 113: 9623-28. PubMed
- Su P, et al. 2016. J Immunol. 197: 1054-64. PubMed
- Morozumi Y, et al. 2016. J Mol Cell Biol. 8:349-62. PubMed
- Miura Y, et al. 2016. Biochem J. 473:2591-602. PubMed
- Pashkova N, et al. 2016. Cell Rep. 17:303-15. PubMed
- Sanchez M, et al. 2016. J Biol Chem. 291:19760-73. PubMed
- Hwang J, Lee J, Pallas D 2016. J Biol Chem. 291:21008-19. PubMed
- Jiménez-Canino R, et al. 2016. J Biol Chem. 291:19068-78. PubMed
- Barquilla A, et al. 2016. Mol Biol Cell. 27:2757-70. PubMed
- Yadav S, et al. 2016. Sci Rep. 6:34100. PubMed
- Hashimoto A, et al. 2016. Oncogenesis. 0.388194444. PubMed
- Guirouilh-Barbat J, et al. 2016. PLoS Genet. 12:e1006230. PubMed
- Gómez-H L, et al. 2016. Nat Commun. 7:13298. PubMed
- Rademacher N, et al. 2016. Sci Rep. 6:35283. PubMed
- Lin Z, et al. 2016. Nat Genet. 10.1038/ng.3701. PubMed
- Kaczmarska Z, et al. 2016. Nat Chem Biol. 10.1038/nchembio.2217. PubMed
- Zee B, et al. 2016. PLoS One. 11:e0163820. PubMed
- Despras E, et al. 2016. Nat Commun. 7:13326. PubMed
- Zhang H, et al. 2016. J Neurosci. 36:11837-50. PubMed
- Zhang M, et al. 2016. Cell Res. 26:1302-19. PubMed
- Baehr C, et al. 2016. J Biol Chem. 291:26875-85. PubMed
- Boehm E, et al. 2016. J Biol Chem. 291:25877-87. PubMed
- Gail Kilroy, et al. 2016. J Biol Chem. 291:27289-97. PubMed
- Hongchen Cai, Aimin Liu 2016. Proc Natl Acad Sci U S A. 113:14751-6. PubMed
- Tam K, et al. 2016. MBio. 7:e02024-16. PubMed
- Hanke L, et al. 2016. MBio. 7(6). pii: e01569-16. PubMed
- Stoeber M, et al. 2016. Proc Natl Acad Sci U S A. 113(50):E8069-E8078. PubMed
- Gu Q, et al. 2016. J Virol. 90:10545-57. PubMed
- Ramachandran S, et al. 2016. J Biol Chem. 291: 25489-504. PubMed
- Kaufmann T, et al. 2016. J Cell Sci. 129:4607-21. PubMed
- Piwko W, et al. 2016. EMBO J. 35:2584-601. PubMed
- Matsuo Y, et al. 2016. J Cell Sci. 129:4592-606. PubMed
- Athmer J, et al. 2017. MBio. 10.1128/mBio.02320-16. PubMed
- Gao L, et al. 2017. J Cell Sci. 130:396-405. PubMed
- Gong Y, et al. 2017. Genes Dev. 31:46-58. PubMed
- K Kataoka, K Mochizuki 2017. J Cell Sci. 130:480-9. PubMed
- Liszczak G, et al. 2017. Proc Natl Acad Sci U S A. 114:681-6. PubMed
- Haggie P, et al. 2017. J Biol Chem. 292:771-85. PubMed
- T Taetzsch, et al. 2017. J Neurosci. 37:70-82. PubMed
- Yagita Y, et al. 2017. J Biol Chem. 292:691-705. PubMed
- Chong Jiang, et al. 2017. J Biol Chem. 292:3137-45. PubMed
- Maeda R, et al. 2017. J Biol Chem. 292:3201-12. PubMed
- Davis RB, et al. 2017. JCI Insight. 2:e92465. PubMed
- Daniel JA, et al. 2017. Elife. 6:e26338. PubMed
- Oishi A, et al. 2017. Sci Rep. 7:8990. PubMed
- RRID
- AB_2910500 (BioLegend Cat. No. 901537)