TotalSeq™-A0575 anti-human CD49a Antibody -上海雅吉生物科技有限公司

规格	价格	库存
10µg	￥ 5166	1

Product Details

Verified Reactivity

Human

Reported Reactivity

African Green, Baboon, Cynomolgus, Rhesus

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Human CTL line

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq?-A oligomer under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.

Application Notes

Additional reported applications include: immunoprecipitation¹,?immunohistochemical staining¹?of acetone-fixed frozen tissue sections, and spatial biology (IBEX)^3,4.

Additional Product Notes

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

Application References (PubMed link indicates BioLegend citation)

Hemler ME, et al. 1984. J.Immunol. 132:3011
Hemler ME, et al. 1985. J. Biol. Chem. 260:15246
Radtke AJ,?et al. 2020.?Proc Natl Acad Sci USA. 117:33455-33465. (SB)?PubMed
Radtke AJ,?et al. 2022.?Nat Protoc. 17:378-401. (SB)?PubMed

Product Citations

Hao Y, et al. 2021. Cell. 184:3573. PubMed

RRID

AB_2783195 (BioLegend Cat. No. 328315)

Antigen Details

Structure

Integrin alpha chain family, Type I membrane protein, alpha chain of heterodimeric integrin receptor, 200 kD. Associates with CD29 to form VLA-1 complex

Distribution

Activated T cells, monocytes, NK cells, smooth muscle cells, neuronal cells, fibroblasts, and mesenchymal cells

Function

Adhesion, leukocyte migration

Ligand/Receptor

With integrin β₁ (CD29) forms receptor for laminin-1 and collagen IV

Cell Type

Fibroblasts, Mesenchymal cells, Mesenchymal Stem Cells, Monocytes, NK cells, T cells

Biology Area

Immunology, Stem Cells

Molecular Family

Adhesion Molecules, CD Molecules

Antigen References

Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiley-Liss Press. p122
Boiret N, et al. 2005. Exp. Hematol. 33:219

Gene ID