Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The TC15-12F12.2 antibody has been reported to enhance the production of IFN-? by Th1 cells stimulated through TCR. Additional reported applications (for the relevant formats) include: immunoprecipitaion¹⁷, enhancing IFN-? production by Th1 cells when stimulated with CD3¹, and inhibiting CD3 induced T cell proliferation⁶. The Ultra-LEAF? purified antibody (Endotoxin <0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 115949 & 115950).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Castro AG, et al. 1999. J. Immunol. 163:5860. (FC, Costim, IP)
2. Forsberg EC, et al. 2005. PLoS Genet. 1:e28. (FC)
3. Terrazas LI, et al. 2005. Int. J. Parasitol. 35:1349. (FC)
4. Cannons JL, et al. 2006. J. Exp. Med. 203:1551. (FC)
5. Umemoto T, et al. 2006. J. Immunol. 177:7733. (FC)
6. Jordan MA, et al. 2007. J. Immunol. 178:1618. (FC, Block) PubMed
7. Jung Y, et al. 2007. Blood 110:82. PubMed
8. Pimanda JE, et al. 2007. Proc. Natl. Acad. Sci. USA 104:840.
9. Sugiyama T, et al. 2007. Proc. Natl. Acad. Sci. USA 104:175.
10. Kim I, et al. 2006. Blood 108:737. PubMed
11. Ema H, et al. 2006. Nat Protoc. 1:2979. PubMed
12. Fraser ST, et al. 2007. Blood 109:4616. PubMed
13. Jung Y, et al. 2008. Stem Cells. 26:2042. Pubmed
14. Song J, et al. 2010. Blood 115:2592. PubMed
15. Cridland SO, et al. 2009. Blood Cell. Mol. Dis. 43:149. (FC) PubMed
16. Morita Y, et al. 2010. J. Exp Med. 207:1173. PubMed
17. Talaei N, et al. 2015. J. Immunol. 195(10):4623. PubMed

Thymocytes, T cell subset, B lymphocytes, dendritic cells, endothelial cells

1. Cocks BG, et al. 1995. Nature 376:260.
2. Punnonen J, et al. 1997. J. Exp. Med. 185:993.
3. Sidorenko SP, et al. 1993. J. Immunol. 151:4614.