Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The RPA-T4 antibody binds to the D1 domain of CD4 (CDR1 and CDR3 epitopes) and can block HIV gp120 binding and inhibit syncytia formation. Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections^3,4,5, blocking of T cell activation^1,2, and spatial biology (IBEX)^10,11.? This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 300569 - 300574).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York. (Activ)
2. Moir S, et al. 1999. J. Virol. 73:7972. (Activ)
3. Deng MC, et al. 1995. Circulation 91:1647. (IHC)
4. Friedman T, et al. 1999. J. Immunol. 162:5256. (IHC)
5. Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
6. Lan RY, et al. 2006. Hepatology 43:729.
7. Zenaro E, et al. 2009. J. Leukoc. Biol. 86:1393. (FC) PubMed
8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
9. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
10. Radtke AJ,?et al. 2020.?Proc Natl Acad Sci USA. 117:33455-33465. (SB)?PubMed
11. Radtke AJ,?et al. 2022.?Nat Protoc. 17:378-401. (SB)?PubMed

1. Stuart T, et al. 2019. Cell. 177:1888. PubMed
2. Cadot S, et al. 2020. Biomark Res. 0.383333333. PubMed
3. Swanson E, et al. 2021. eLife. 10:00. PubMed
4. Hao Y, et al. 2021. Cell. 184:3573. PubMed

T cell subset, majority of thymocytes, monocytes/macrophages

1. Center D, et al. 1996. Immunol. Today 17:476.
2. Gaubin M, et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723.