Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone RB6-8C5 binds with high affinity to mouse Ly-6G molecules and to a lower extent to Ly-6C¹⁹. Clone RB6-8C5 impairs the binding of anti-mouse Ly-6G clone 1A8¹⁹. However, clone RB6-8C5 is able to stain in the presence of anti-mouse Ly-6C clone HK1.4²⁰.

The RB6-8C5 antibody has been used to identify peripheral blood neutrophils and deplete granulocytes in vivo. Additional reported applications (for relevant formats of this clone) include: in vitro complement-mediated cytotoxicity², in vivo depletion^3-5,9, immunoprecipitation¹, immunohistochemical staining⁶ (including paraffin-embedded sections^9,16,33-35, acetone-fixed frozen sections¹¹ and zinc-fixed sections¹⁵), and Western blotting⁷. RB6-8C5 is not suitable for depletion of hepatic myeloid derived suppressor cells (MDSCs)²⁰.

Special Note:?For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF? purified antibody (Cat. No. 108436).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Fleming TJ, et al. 1993. J. Immunol. 151:2399. (IP)
2. Brummer E, et al. 1984. J. Leukocyte Biol. 36:505. (CMCD)
3. Stoppacciaro A, et al. 1993. J. Exp. Med. 178:151. (Deplete)
4. Tumpey TM, et al. 1996. J. Virol. 70:898. (Deplete)
5. Czuprynski CJ, et al. 1994. J. Immunol. 152:1836. (Deplete)
6. Nitta H, et al. 1997. Cell Vision 4:73. (IHC)
7. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819. (WB)
8. Engwerda CR, et al. 2004. Am. J. Pathol. 165:2123.
9. Brown CR, et al. 2004. Infect. Immun. 72:4956. (Deplete, IHC)
10. Andoniou CE, et al. 2005. Nature Immunology 6:1011. (FC) PubMed
11. Li M, et al. 2006. P. Natl. Acad. Sci USA 103:11736. (IHC)
12. Dzhagalov I, et al. 2007. Blood 109:1620. (FC) PubMed
13. Fazilleau N, et al. 2007. Nature Immunol. 8:753. (FC) PubMed
14. Heuser M, et al. 2007. Blood 110:1639. (FC) PubMed
15. Wang T, et al. 2007. Infect. Immun. 75:1144. (IHC)
16. Bosio CM, et al. 2007. J. Immunol. 178:4538. (IHC)
17. Boehme SA, et al. 2009. Int. Immunol. 21:81. (IHC)
18. Piao Y, et al. 2012. Neuro Oncol. 14:1379. PubMed
19. Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
20. Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
21. Li J, et al. 2012. Arthritis Rheum. 64:1098. PubMed
22. Fan Q, et al. 2014. Cancer Res. 74:471. PubMed
23. Korrer MJ, et al. 2014. PLoS One. 9:91370. PubMed
24. Morshed M, et al. 2014. J Immunol. 192:5314. PubMed
25. Collins C, et al. 2014. PNAS. 111:9899. PubMed
26. Madireddi S, et al. 2014. J Exp Med. 211:1433. PubMed
27. Bianchi G, et al. 2014. Cell Death Dis. 5:1135. PubMed
28. Guo H, et al. 2014. J Leukoc Biol. 96:419. PubMed
29. Roderick JE, et al. 2014. PNAS. 111:14436. PubMed
30. Distel E, et al. 2014. Circ Res. 115:759. PubMed
31. Iwai H, et al. 2015. Tuberculosis. 95:246. PubMed
32. Charmsaz S, et al. 2015. PLoS One. 10:130692. PubMed
33. Whiteland J, et al. 1994 J Histochem Cytochem 43:3 (IHC-P)
34. Brown C, et al. 2003 J Immunology 171:2 (IHC-P)
35. Obregon-Henao A, et al. PLoS One 8:11 (IHC-P)

1. Pisu D, et al. 2021. J Exp Med. 218:. PubMed

Granulocytes, monocytes

1. Fleming TJ, et al. 1993. J. Immunol. 151:2399.
2. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819.
3. Goni O, et al. 2002. Int. Immunol. 14:1125.