Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone RA3-6B2 has been described to react with an epitope on the extracellular domain of the transmembrane CD45 glycoprotein which is dependent upon the expression of exon A and specific carbohydrate residues. Additional reported applications (for the relevant formats) include: immunoprecipitation¹, in vitro and in vivo modulation of B cell responses^2-4, immunohistochemistry of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections^5,6, and spatial biology (IBEX)^14,15.

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Coffman RL. 1982. Immunol. Rev. 69:5. (IP)
2. George A, et al. 1994. J. Immunol. 152:1014. (Activ)
3. Asensi V, et al. 1989. Immunology 68:204. (Activ)
4. Domiati-Saad R, et al. 1993. J. Immunol. 151:5936. (Activ)
5. Hata H, et al. 2004. J. Clin. Invest. 114:582. (IHC)
6. Monteith CE, et al. 1996. Can. J. Vet. Res. 60:193. (IHC)
7. Shih FF, et al. 2006. J. Immunol. 176:3438. (FC)
8. Chang C L-T, et al. 2007. J. Immunol. 178:6984.
9. Fazilleau N, et al. 2007. Nature Immunol. 8:753.
10. Lang GL, et al. 2008. Blood 111:2158. PubMed
11. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
12. del Rio ML, et al. 2011. Transpl. Int. 24:501. (FC) PubMed
13. Murakami R, et al. 2013. PLoS One. 8:73270. PubMed
14. Radtke?AJ,?et al.?2020.?Proc Natl Acad Sci U S A.?117:33455-65. (SB)?PubMed
15. Radtke?AJ,?et al.?2022.?Nat Protoc.?17:378-401. (SB)?PubMed

1. Lee RD, et al. 2021. Nat Commun. 12:6843. PubMed
2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
4. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed

B cells, T cell subset, NK cell subset

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Trowbridge IS, et al. 1993. Annu. Rev. Immunol. 12:85.
3. Kishihara K, et al. 1993. Cell 74:143.
4. Pulido R, et al. 1988. J. Immunol. 140:3851.