Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The DX2 antibody is useful for inducing apoptosis of Fas-positive cells. Additional reported applications (for the relevant formats) include: in vitro induction of apoptosis³ (DX2 antibody is required to be cross-linked for effective induction of apoptosis) and immunohistochemical staining^4,5 of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 305655 and 305656).

Note: EOS9.1 antibody can induce apoptosis without cross-linking.

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. Schlossman S, et al. Eds.1995. Leucocyte Typing V. Oxford University Press. New York.
2. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York.
3. Cifone M, et al. 1994. J. Exp. Med. 180:1547. (Apop)
4. Zietz C, et al. 2001. Am. J. Pathol. 159:963. (IHC)
5. Sergi C, et al. 2000. Am. J. Pathol. 156:1589. (IHC)
6. Xie S, et al. 2010. J. Immunol. 184:2289. (FC) PubMed
7. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
8. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
9. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
10. Dixit N, et al. 2012. J. Immunol. 189:5954. PubMed

T cells and B cells, monocytes, neutrophils, fibroblasts, expression level upregulated on activated lymphocytes

1. Krammer P, et al. 1994. Immunol. Rev. 142:175.
2. Nagata S, et al. 1995. Science 267:1449.