| 规格 | 价格 | 库存 |
|---|---|---|
| 10µg | ¥ 5166 | 1 |
PG - Quality tested
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
The 1D11 antibody blocks MICA binding to T cells, induces redirected lysis, and costimulates T cells activation and proliferation. Additional reported (for the relevant formats) applications include: immunoprecipitation1,2, blocking of ligand binding, induction of redirected cell lysis, and costimulation of T cells proliferation2-7. For highly sensitive assays, we recommend Ultra-LEAF? purified antibody (Cat. No. 320814) with endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered.
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Application Technical Notes.
NK cells, γ/δ T cells, CD8+ T cells
1. Vance RE, et al. 1999. J. Exp. Med. 190:1801.
2. Raulet DH. 2003. Nat. Rev. Immunol. 3:781.
3. Lohwasser S, et al. 1999. Eur. J. Immunol. 29:755.
4. Jamieson AM, et al. 2002. Immunity 17:19.
5. Gilfillan S, et al. 2002. Nat. Immunol. 3:1150.
6. Ho EL, et al. 2002. J. Immunol. 169:3667.
7. Maasho K, et al. 2005. J. Immunol. 174:4480.
8. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.