Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Anti-mouse TLR4 clones SA15-21 and MTS510 recognize distinct epitopes and don’t cross block each other.⁸ Clone MTS510 binds to an epitope of TLR4/MD-2 that is lost after LPS stimulation.⁸ In addition to flow cytometric uses, the MTS510 antibody has also been used for immunoprecipitation, immunofluorescence, and blocking of LPS-induced stimulation. The LEAF? purified antibody (Endotoxin <0.1 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 117607). For highly sensitive assays, we recommend Ultra-LEAF? purified antibody (Cat. No. 117612) with a lower endotoxin limit than standard LEAF? purified antibodies (Endotoxin <0.01 EU/?g).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Akashi S, et al. 2000. J. Immunol. 164:3471. (FC, ICFC, IP, Block)
2. Kawasaki K, et al. 2003. J. Immunol. 170:413. (FC)
3. Nalbandian G, et al. 2005. J. Immunol. 175:2666. (FC) PubMed
4. Kanada S, et al. 2011. Blood 117:2211. PubMed
5. Laplate P, et al. 2011. J. Biol Chem. 286:42494. PubMed
6. Khan MA, et al. 2006. Infect. Immun. 74:2522. (IF)
7. Tanigawa T, et al. 2013. Innate Immun. 19:115. PubMed
8. Akashi S, et al. 2003. J. Exp. Med. 198:1035.

1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
2. Pisu D, et al. 2021. J Exp Med. 218:. PubMed

Monocytes, B cells and T cells

1. Frleta D, et al. 2003. J. Leukocyte Biol. 74:1064.