Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The L243 monoclonal antibody reacts with the HLA-DR antigen, a member of MHC class II molecules. It does not cross react with HLA-DP and HLA-DQ. Clone L243 binds a conformational epitope on HLA-DRa which depends on the correct folding of the a? heterodimer.¹⁹

Additional reported applications (for the relevant formats) include: immunoprecipitation⁸, Western blotting⁸, in vitro blocking of mixed lymphocyte reactions^9,10, depeletion of MHC class II cells⁷,?immunohistochemical staining of acetone-fixed frozen sections^4,5, and spatial biology (IBEX)^21,22. For sensitive functional assays, we recommend using the Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) (Cat. No. 307648, 307665 - 307669).

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. Brodsky F. 1984. Immunogenetics 19:179.
2. Robbins P, et al. 1987. Human Immunol. 18:301.
3. Stites D, et al. 1986. Clin. Immunol. Immunopathol. 38:161.
4. Warnke R, et al. 1980. J. Histochem. Cytochem. 28:771. (IHC)
5. Engleman E, et al. 1981. P. Natl. Acad. Sci. USA 78:1791. (IHC)
6. Zipf T, et al. 1981. Cancer Res. 41:4786.
7. Goodier M, et al. 2000. J. Immunol. 165:139. (Depletion)
8. Esser M, et al. 2001. J. Virol. 75:6173. (IP, WB)
9. Kalka-Moll WM, et al. 2002. J. Immunol. 169:6149. (Block)
10. Wang RF, et al. 1999. Science 284:1351. (Block)
11. Zaba LC, et al. 2007. J. Exp. Med. 204:3183. PubMed
12. Fujita H, et al. 2009. P. Natl. Acad. Sci. USA 106:21795. PubMed
13. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
14. Goncalves RM, et al. 2010. Infect. Immun. 78:4763. PubMed
15. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
16. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
17. Stein R, et al. 2011. Leuk. Lymphoma 52:273.
18. Galkowska H, et al. 1996. Vet. Immunol. Immunopathol. 53:329.
19. Moro M, et al. 2005. BMC Immunol. 6:24.
20. Lauterbach N, et al. 2014. Mol Immunol. 59:19. PubMed
21. Radtke AJ,?et al. 2020.?Proc Natl Acad Sci USA. 117:33455-33465. (SB)?PubMed
22. Radtke AJ,?et al. 2022.?Nat Protoc. 17:378-401. (SB)?PubMed

B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs

1. Levacher M, et al. 1990. Clin. Exp. Immunol. 81:177.
2. Terstappen L, et al. 1990. J. Leukocyte Biol. 48:138.
3. Edwards JA, et al. 1986. J. Immunol. 137:490.
4. van Es A, et al. 1984. Transplantation 37:65.
5. O'Doherty U, et al. 1994. Immunology 82:487.
6. Thomas R, et al. 1994. J. Immunol. 153:4016.
7. Grouard G, et al. 1996. Nature 384:364.