| 规格 | 价格 | 库存 |
|---|---|---|
| 10µg | ¥ 4428 | 1 |
PG - Quality tested
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Clone IM7 has been reported to recognize an epitope common to alloantigens and all isoforms of CD4417,18 that is located between amino acids 145 and 18620. This clone has been verified for?immunocytochemistry (ICC) and frozen immunohistochemistry (IHC-F). Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections6,7, complement-mediated cytotoxicity1, immunoprecipitation1,3, in vivo inhibition of DTH4,5, and spatial biology (IBEX)23,24. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 103046, 103065 - 103069).
Cross-reactivity to ferret has been reported by a collaborator, but not verified in house.
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Scientific Poster Library.
All leukocytes, epithelial cells, endothelial cells, hepatocytes, mesenchymal cells
1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Haynes BF, et al. 1991. Cancer Cells 3:347.
3. Goldstein LA, et al. 1989. Cell 56:1063.
4. Mikecz K, et al. 1995. Nat. Med. 1:558.
5. Hegde V, et al. 2008. J. Leukocyte Biol. 84:134.
6. Liu T, et al. 2009. Biol. Direct 4:40.