Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The ICRF44 antibody inhibits heterotypic adhesion of granulocytes in response to fMLP. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, immunofluorescence microscopy⁵, stimulation of monocytes³, blocking of heterotypic PMN aggregation⁸, and blocking of granulocyte activation¹². This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue.

The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. Nos. 301361 & 301362).

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. Knapp W. 1989. Leucocyte Typing IV. Oxford University Press New York.
2. Barclay N, et al. 1997. The Leucocyte Antigen Facts Book. Academic Press Inc. San Diego.
3. Rezzonico R, et al. 2001. Blood 97:2932. (Stim)
4. Marsik C, et al. 2003. Shock 20:493. (FC)
5. David A, et al. 2003. J. Leukoc. Biol. 74:551. (IF)
6. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
7. Thurlow LR, et al. 2010. Infect. Immun. 128:1128. (FC) PubMed
8. Jadhav S, et al. 2001. J. Immunol. 167:5986. (Block)
9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
10. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. (FC)
11. Wen T, et al. 2014. J Immunol. 192:5481. (FC) PubMed
12. Sprong T, et al. 2003. Blood 102:3702. (Block)
13. Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
14. Larsson K, et al. 2015. PNAS. PubMed

Granulocytes, monocytes/macrophages, dendritic cells, NK cells, subset of T cells, subset of B cells

1. Stewart M, et al. 1995. Curr?Opin?Cell Biol. 7:690.