Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications (for the relevant formats) include: immunoprecipitation¹, immunohistochemistry⁴ of acetone-fixed frozen sections, in vitro blocking of the adhesion of mouse tumor cell lines to extracellular matrix proteins and in vitro inhibition of T cell proliferative responses¹, and in vivo inhibition of neutrophil migration². The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 102235 and 102236).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Noto K, et al. 1995. Int. Immunol. 7:835.
2. Ridger VC, et al. 2001. J. Immunol. 166:3484.
3. Jia W, et al. 2005. Blood 106:3854.PubMed
4. Economopoulou M, et al. 2005. Blood 106:3831.
5. Lawson BR, et al. 2007. J. Immunol. 178:5366.
6. Eisenmann KM, et al. 2007. J. Biol. Chem. doi:10.1074/jbc.M703243200.PubMed
7. Hayashi Y, et al. 2008. Am J Physiol Gastrointest Liver Physiol. 294:G778. PubMed
8. Kim DT, et al. 2008. Blood 111:2929.PubMed
9. Hayashi Y, et al. 2008. J Pharmacol Exp Ther. 326:523. PubMed
10. Carlson TR, et al. 2008. Development. 135:2193. PubMed
11. Sangaletti S, et al. 2008. Cancer Res. 68:9050. (Block) PubMed
12. Baker CM, et al. 2012. PNAS. PubMed.
13. Hirokawa Y, et al. 2014. Am J Physiol Gastrointerest Liver Physiol. 306:547. PubMed

Leukocytes, endothelial cells, smooth muscle, epithelial cells

1. Noto K, et al. 1995. Int. Immunol. 7:835.
2. Springer TA. 1990. Nature 346:425.