TotalSeq™-D0359 anti-human CD83 Antibody
- 产品名称:
- TotalSeq™-D0359 anti-human CD83 Antibody
- 产品类别:
- 抗体
- 产品编号:
- 305345
- 产品应用:
- 305345
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Pigtailed Macaque, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform. - Application Notes
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4.
- Additional Product Notes
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Application Technical Notes.
- Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press New York.
- Zhou L, et al. 1995. J. Immunol. 154:3821.
- Cao W, et al. 2005. Biochem. J. 385:85.
- Lore K, et al. 2002. AIDS 16:683. (IHC)
- Cho H, et al. 2007. Physiol Genomics doi:10.1152/physiolgenomics.00051.2006
- RRID
- AB_2892362 (BioLegend Cat. No. 305345)
- Structure
- Ig superfamily, single chain transmembrane glycoprotein, 43 kD
- Distribution
-
Dendritic cells, Langerhan cells, activated B and T cells
- Cell Type
- B cells, Dendritic cells, Langerhans cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kozlow E, et al. 1993. Blood 81:454.
2. Zhou L, et al. 1992. J. Immunol. 149:735.
3. Zhou L, et al. 1995. Blood 86:3295.
- Gene ID
- 9308 View all products for this Gene ID
- UniProt
- View information about CD83 on UniProt.org