| 规格 | 价格 | 库存 |
|---|---|---|
| 10µg | ¥ 4428 | 1 |
PG -?Quality tested
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
The GL-1 antibody can block the mixed lymphocyte reaction in vitro and has been shown to inhibit the priming of cytotoxic T lymphocytes in vivo (along with antibodies against B7-1). Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunohistochemical staining of acetone-fixed frozen sections2,6, immunofluorescence microscopy, and in vivo and in vitro blocking of T cell responses1-6. GL-1 is not suitable for immunohistochemical staining of formalin-fixed paraffin sections. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 105051-105056).
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Scientific Poster Library.
B cells and T cells (upregulated upon activation), macrophages, dendritic cells, and astrocytes
1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Hathcock KS, et al. 1993. Science 262:905.
3. Freeman GJ, et al. 1993. Science 262:907.
4. Carreno BM, et al. 2002. Annu. Rev. Immunol. 20:29.