Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications (for the relevant formats) include: Western blotting¹ under non-reducing conditions, immunoprecipitation¹, immunohistochemistry³ of snap frozen sections, and blocking¹ of IFN-? binding to IFN-? R a chain. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 308606) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204)). The Ultra-LEAF? Purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. Nos. 308609 & 308610).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Sheehan K, et al. 1988. J. Immunol. 140:4231. (WB IP Block)
2. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
3. Peyman JA, et al. 1992. J. Immunol. 149:2675. (IHC)

1. Hao Y, et al. 2021. Cell. 184:3573. PubMed

Macrophages, monocytes, B, T, and NK cells, neutrophils, endothelial and epithelial cells, fibroblasts

1. Calderon J, et al. 1988. P. Natl. Acad. Sci. USA 85:4837.
2. Basler C, et al. 2002. Int. Rev. Immunol. 21:305.
3. Brierley M, et al. 2002. J. Interferon Cytokine Res. 22:835.