Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications for clone G8.8 (for the relevant formats) include: immunohistochemistry of?frozen sections: acetone fixed¹, with or without OCT embedding^2,4, and spatial biology (IBEX)^13,14.

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Farr A, et al. 1991. J. Histochem. Cytochem. 39:645. (FC, IHC)
2. Dooley J, et al. 2005. J. Immunol. 175:4331. (FC, IHC)
3. Hinterberger M, et. al. 2010. Nat. Immunol. 11:512. (FC) PubMed
4. Gracz AD, et al. 2010. Am J. Physiol Gastrointest Liver Physiol. 298:590. (IHC) PubMed
5. Nudel I, et al. 2011. J. Immunol. 186:891. PubMed
6. Morimoto H, et al. 2012. Biol Reprod. 86:148. PubMed
7. Ishii K, et al. 2012. Development. 139:1734. PubMed
8. Takehashi M, et al. 2012. Biol Reprod. 86:178. PubMed
9. Murakami R, et al. 2013. PLoS One. 8:73270. PubMed
10. Taguchi K, et al. 2014. Mol Cell Biol. 34:900. PubMed
11. Hirokawa Y, et al. 2014. Am J Physiol Gastrointerest Liver Physiol. 306:547. PubMed
12. Ding X, et al. 2015. Cancer Res. 75:330. PubMed
13. Radtke?AJ,?et al.?2020.?Proc Natl Acad Sci U S A.?117:33455-65. (SB)?PubMed
14. Radtke?AJ,?et al.?2022.?Nat Protoc.?17:378-401. (SB)?PubMed

Expressed on majority of epithelial cell membranes with the exception of adult squamous cells of the skin and a few specific epithelial cell types.

1. Borkowski TA, et al. 1996. Eur. J. Immunol. 26:110.
2. Bergsagel PL, et al. 1992. J. Immunol. 148:590.