| 规格 | 价格 | 库存 |
|---|---|---|
| 10µg | ¥ 4428 | 1 |
PG - Quality tested
Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
The CC2C6 monoclonal antibody can block the binding of HCD47 antibody to CD47.
Additional reported applications (for the relevant formats) include: blocking2
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Application Technical Notes.
Wide distribution in hematopoietic cells including thymocytes, T cells, B cells, platelets, and erythrocytes as well as epithelial cells, endothelial cells, fibroblasts, and neural tissues.
1. Anstee DJ, et al. 1995. In Leucocyte Typing V (Schlossman ed.) Oxford University Press Oxford pp233-234.
2. Brown E, et al. 1990. J. Cell Biol. 111:2785.
3. Gao AG, et al. 1996. J. Biol. Chem. 271:21.
4. Lindberg FP, et al. 1994. J. Biol. Chem. 269:1567.