Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections^1,2 and formalin-fixed paraffin-embedded sections^6,7, Western blotting, and spatial biology (IBEX)^12,13.

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Schaller E, et al. 2002. Mol. Cell. Biol. 22:8035. (IHC)
2. Stevceva L, et al. 2001. BMC Clin Pathol. 1:3. (IHC)
3. Kobayashi M, et al.2008. J. Leukoc. Biol. 83:1354. PubMed
4. Poeckel D, et al. 2009. J. Biol Chem. 284:21077. PubMed
5. Glass AM, et al. 2013. J. Immunol. 190:4830. PubMed
6. Koehm S, et al. 2007. J. Allergy Clin. Immunol. 120:570. (IHC)
7. Rankin AL, et al. 2010. J. Immunol. 184:1526. (IHC)
8. Sasi SP, et al. 2014. J Biol Chem. 289:14178. PubMed
9. Thakus VS, et al. 2014. Toxicol Lett. 230:322. PubMed
10. Watson NB, et al. 2015. J Immunol. 194:2796. PubMed
11. Hirakawa H, et al. 2015. PLoS One. 10:119360. PubMed
12. Radtke?AJ,?et al.?2020.?Proc Natl Acad Sci U S A.?117:33455-65. (SB)?PubMed
13. Radtke?AJ,?et al.?2022.?Nat Protoc.?17:378-401. (SB)?PubMed

1. R?dahl I, et al. 2021. STAR Protoc. 2:100842. PubMed
2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
4. Wirka RC, et al. 2019. Nat Med. 25:1280. PubMed
5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
6. Pisu D, et al. 2021. J Exp Med. 218:. PubMed

Majority of tissue macrophages including peritoneal macrophages, macrophages in lung, gut, thymus and red pulp of spleen, Kuffer cells, Langerhans cells, bone marrow stromal cells, and a subset of dendritic cells

1. Austy JM and Gordon S. 1981. Eur. J. Immunol. 11:805.
2. Hume DA, et al. 1983. J. Exp. Med. 158:1522.
3. Ruedl C, et al. 1996. Eur. J. Immunol. 26:1801.
4. McKnight AJ, et al. 1996. J. Biol. Chem. 271:486.
5. Lin HH, et al. 2005. J. Exp. Med. 201:1615.