Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications (for the relevant formats) include: blocking of ligand binding¹. The LEAF? purified antibody (Endotoxin <0.1 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays.

It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation.?Pre-treatment with EDTA and low temperatures (2 to 8°C) helps in maintaining surface expression of CD115⁴.

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Sudo T, et al. 1995. Oncogene 11:2469.
2. Murayama T, et al. 1999. Circulation 99:1740.
3. Jaeger BN, et al. 2012. J. Exp. Med. 209:565. PubMed
4. Breslin WL, et al. 2013. J Immunol Methods. 390(1-2):1 PubMed
5. Dong L, et al. 2016. Nature. 539:304–308. PubMed

Monocytes/macrophages, peritoneal exudate cells, plasmacytoid and conventional dendritic cells, osteoclasts

1. Sudo T, et al. 1995 Oncogene 11:2469.
2. Murayama T, et al. 1999 Circulation 99:1740.
3. Goswami S, et al. 2005 Cancer Res. 65:5278.
4. Yu W, et al. 2008 J. Leuko. Biol. 84:852.