Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

The A1 antibody binds to the human CD39 cell surface antigen and has been shown to block MHC independent target cell recognition by hapten-specific CTL. Additional reported applications (for the relevant formats) include: in vitro CD39 blockade³,? immunofluorescence⁴,?immunohistochemistry⁶, and spatial biology (IBEX)^7,8. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for blocking assays (contact our custom solutions team).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Aversa GG, et al. 1988. Transplant. P. 20:4952.
2. Aversa GG, et al. 1989. Transplant. P. 21:34950.
3. Borsellino G, et al. 2007. Blood. 110:1225. (Block)
4. Stockl J, et al. 2001. J. Immunol. 167:2724. (IF)
5. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
6. Lyck L, et al. 2008. J. Histochem. Cytochem. 56:201. (IHC)
7. Radtke AJ,?et al. 2020.?Proc Natl Acad Sci USA. 117:33455-33465. (SB)?PubMed
8. Radtke AJ,?et al. 2022.?Nat Protoc. 17:378-401. (SB)?PubMed

1. Swanson E, et al. 2021. eLife. 10:00. PubMed
2. Hao Y, et al. 2021. Cell. 184:3573. PubMed

Activated lymphocytes, and also on a subset of T cells, regulatory T cells, B cells, and dendritic cells.