Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone 93 can be used for blocking of CD16/CD32 interactions with the Fc domain of immunoglobulins, but is not the same clone as 2.4G2.

The 93 mAb is specific to the common epitope of CD16/CD32. Additional reported applications (for the relevant formats) include: immunoprecipitation¹ and blocking of Fc-mediated reactions in functional studies^2,4,23. It is useful for blocking non-specific binding of immunoglobulin to Fc receptors. For blocking of Fc receptors in flow cytometric analysis, pre-incubate the cells with purified anti-CD16/CD32 antibody (=1.0 ?g per 10⁶ cells in 100 ?L volume) for 5-10 minutes on ice prior to immunostaining. For highly sensitive assays, we recommend Ultra-LEAF? purified antibody (Cat. No. 101330) (Endotoxin <0.01 EU/?g, Azide-Free, 0.2 ?m filtered).

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Scientific Poster Library.

1. Personal communication (IP)
2. Oliver AM, et al. 1999. Hybridoma 18:113. (Block)
3. Brummel R and Lenert P. 2005. J. Immunol. 174:2429.
4. Terrazas LI, et al. 2005. Int. J. Parasitol. 35:1349. (Block)
5. Clements JL, et al. 2006. J. Immunol. 177:905.
6. Mohamed W, et al. 2010. Infect Immun. 78:3306. PubMed
7. Ouchi T, et al. 2011. J. Exp Med. 208:2607. PubMed
8. Kmieciak M, et al. 2011. J. Vis. Exp. 47:2381. PubMed
9. Yamazaki S, et al. 2012. PLoS One. 7:e51665. PubMed
10. Li J, et al. 2012. Arthritis Rheum. 64:1098. PubMed
11. Azuma M, et al. 2012. Oncoimmunology. 1:581. PubMed
12. Koon HW, et al. 2013. J. Vis. Exp. 68:4208. PubMed
13. Hegde VL, et al. 2013. J Biol Chem. 288:36810. PubMed
14. Huang J, et al. 2013. J. Immunol Methods. 387:254. PubMed
15. Dutow P, et al. 2014. J Infect Dis. PubMed
16. Fan Y, et al. 2014. J Exp Med. 211:313. PubMed
17. Huang HN, et al. 2014. Antimicrob Agents Chemother. 58:1538. PubMed
18. Takei S, et al. 2014. Vaccine. 32:3066. PubMed
19. Richardson ML, et al. 2014. PLoS Negl Trop Dis. 8:2825. PubMed
20. Cekanaviciute E, et al. 2014. J Immunol. 193:139. PubMed
21. Kimura T, et al. 2014. Int Immunol. 26:697. PubMed
22. Everad A, et al. 2014. Nat Commun. 5:5648. PubMed
23. Cenci E, et al. 2006. J. Leuko. Biol. 79(1):40-5. (Block)

1. Pisu D, et al. 2021. J Exp Med. 218:. PubMed

B cells, monocyte/macrophages, NK cells, neutrophils, mast cells, dendritic cells

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Unkeless JC. 1989. J. Clin. Invest. 83:355.
3. Qiu WQ, et al. 1990. Science 248:732.