Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone 3F9 recognizes the IL-10-binding epitope of IL-10R1.⁸ Additional reported applications (for the relevant formats) include: immunoprecipitation¹, in vitro blocking^1-3 of human IL-10 binding to IL-10R. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 308804) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-rat IgG second step), followed by SAv-PE (Cat. No. 405204). The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for highly sensitive assays?(Cat. No. 308817 and 308818).

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. Liu Y, et al. 1997. J. Immunol. 158:604. (Immunogen, IP, Block)
2. Levings MK, et al. 2005. Blood 105:1162. (Block)
3. Goodier MR, et al. 2000. J. Immunol. 165:139. (Block)
4. Huang YH, et al. 2009. J. Leukoc. Biol. 86:273. PubMed
5. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
6. Liu BS,et al. 2011. J Leukoc Biol. 89:981. PubMed
7. Joffe M, et al. 2012. Int Immunol. 24:447. PubMed
8. MacDonald KP, et al. 1999. J. Immunol. 163:5599. (epitope)

T cells and B cells, NK cells, monocytes, macrophages

1. Kotenko S. 2002. Cytokine Growth Factor Rev. 13:223.
2. Trinchieri G. 2003. Nat. Rev. Immunol. 3:133.