| 规格 | 价格 | 库存 |
|---|---|---|
| 10µg | ¥ 4428 | 1 |
PG - Quality tested
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Anti-mouse CD31 clones 390 and MEC13.3 bind to their respective non-overlapping epitopes in IgD2 of CD31.8 Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro and in vivo blocking of CD31-mediated cell-cell interactions1-4, and immunohistochemical staining5,6,7 of acetone-fixed frozen sections and zinc-fixed paraffin-embedded sections. Special Note: This antibody is not recommended for formalin-fixed paraffin-embedded sections. The LEAF? purified antibody (Endotoxin < 0.1 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 102412).
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our?Scientific Poster Library.
Endothelial cells, platelets, granulocytes, monocytes/macrophages, dendritic cells, T and B cell subsets
1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. DeLisser HM, et al. 1994. Immunol. Today 15:490.
3. Newman PJ, et al. 1990. Science 247:1219.