Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections¹¹, immunocytochemistry³, immunofluorescence microscopy^2,6, and blocking of CD4-independent infection by HIV-2 and CD4-dependent infection by some T cell-tropic isolates of HIV-1^4,5. Clone 12G5 may not be suitable for Western blotting.¹⁰ The Ultra-LEAF? purified antibody (Endotoxin <0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. Nos. 306539 & 306540).

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. McKnight A, et al. 1997. J. Virol. 71:1692.
2. Endres MJ, et al. 1996. Cell 87:745. (Immunogen, IF)
3. Volin MV, et al. 1998. Biochem. Biophys. Res. Commun. 242:46. (ICC)
4. Berndt C, et al. 1998. P. Natl. Acad. Sci. USA 95:12556. (Block)
5. Ullrich CK, et al. 2000. Blood 96:1438. (Block)
6. Murga M, et al. 2005. Blood 105:1992. (IF)
7. Thompson BD. 2007. J. Biol. Chem. 282:9547. (FC) PubMed
8. Isnardi I, et al. 2010. Blood 115:5026. PubMed
9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
10. Fischer T, et al. 2008. PLoS One 3:e4069.
11. Schmid BC, et al. 2004. Breast Cancer Res. Treat. 84:247. (IHC)

T cells and B cells, dendritic cells, monocytes, granulocytes, hematopoietic progenitors, endothelial cells

1. Berger E, et al. 1999. Annu. Rev. Immunol. 17:657.
2. Loetscher P, et al. 2000. Adv. Immunol. 74:127.
3. Murphy P, et al. 2000. Pharmacol. Rev. 52:145.