Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone 10.1 recognizes the EC3 epitope of CD64. While both contain the EC3 domain, in-house testing suggests that clone 10.1 preferentially binds to CD64A (FcγRIA), but not CD64B (FcγRIB). Additional reported applications (for the relevant formats) include: blocking of human IgG3 and murine IgG2a binding to FcγRI^2,5,6,11 and immunohistochemical staining of acetone-fixed frozen tissue sections¹².

TotalSeq?-D reagents are designed to profile protein expression at single cell level. The?Mission Bio Tapestri platform?and sequencer (e.g. Illumina analyzers) are required. Please contact?technical support?for more information, or visit?biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our?Application Technical Notes.

1. McMichael A, et al. Eds. 1987. Leucocyte Typing III. Oxford University Press. New York.
2. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. p. 874.
3. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
4. Holl V, et al. 2004. J. Immunol. 173:6274.
5. Hober D, et al. 2002. J. Gen. Virol. 83:2169.
6. Cho HJ, et al. 2007. Physiol Genomics 149:60.
7. van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717. PubMed
8. Bruhns P, et al. 2008. Blood 113:3716. PubMed
9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
10. Carter DL, et al. 1999. Cytometry 37:41. (FC)
11. Dougherty GJ, et al. 1987. Eur. J. Immunol. 17:1453.
12. Blom AB, et al. 2003. Arthritis Rheum. 48(4):1002-14. (IHC)

Monocytes, macrophages, dendritic cells, activated granulocytes

1. Hulett M, et al. 1994. Adv. Immunol. 57:1.
2. van de Winkel J, et al. 1993. Immunol. Today 14:215.